Abstract
Mitochondrial forms account approximately 1–2% of all nonsyndromic cases of hearing loss (HL). One of the most common causative variants of mtDNA is the m.1555A > G variant of the MT-RNR1 gene (OMIM 561000). Currently the detection of the m.1555A > G variant of the MT-RNR1 gene is not included in all research protocols. In this study this variant was screened among 165 patients with HL from the Republic of Buryatia, located in the Baikal Lake region of Russia. In our study, the total contribution of the m.1555A > G variant to the etiology of HL was 12.7% (21/165), while the update global prevalence of this variant is 1.8% (863/47,328). The m.1555A > G variant was notably more prevalent in Buryat (20.2%) than in Russian patients (1.3%). Mitogenome analysis in 14 unrelated Buryat families carrying the m.1555A > G variant revealed a predominant lineage: in 13 families, a cluster affiliated with sub-haplogroup A5b (92.9%) was identified, while one family had the D5a2a1 lineage (7.1%). In a Russian family with the m.1555A > G variant the lineage affiliated with sub-haplogroup F1a1d was found. Considering that more than 90% of Buryat families with the m.1555A > G variant belong to the single maternal lineage cluster we conclude that high prevalence of this variant in patients with HL in the Baikal Lake region can be attributed to a founder effect.
Similar content being viewed by others
Introduction
Hearing loss (HL) is one of the most common congenital diseases. The prevalence of congenital and childhood HL in the world is estimated at 1.33 per 1000 newborns1. It is known that up to 50% of cases of congenital HL have a hereditary cause1,2. Currently more than 120 genes associated with HL are known1,2,3. About 70% of hereditary causes of HL are nonsyndromic and 30% are syndromic4. At the same time, approximately 75% of all cases of nonsyndromic HL occur in autosomal-recessive, 10–15% in autosomal-dominant and 1–2% in X-linked recessive and mitochondrial forms1,2. Mitochondrial forms of HL are associated with a pathogenic variants in the genes: MT-RNR1 (OMIM:561000), MT-TS1 (OMIM:590080), MT-CO1 (OMIM:516030), MT-TH (OMIM:590040), MT-ND1 (OMIM:51600), MT-TL1 (OMIM:590050), MT-TE (OMIM:590025) and MT-TK (OMIM:590060), which can lead to both isolated HL and various syndromes, when HL can be combined with the endocrine (diabetes mellitus and deafness, OMIM:520000) and nervous system pathologies (MERRF syndrome, OMIM:545000 and MELAS syndrome, OMIM:540000)5. Despite the low proportion of mitochondrial forms of HL, their role in the etiology of HL was described before the autosomal-recessive form of HL caused of pathogenic variants in the GJB2 gene (DFNB1A, OMIM: 220290). In 1993 Fischel-Ghodsian and colleagues reported discovery of the m.1555A > G variant in the MT-RNR1 gene encoding mitochondrial 12S rRNA in patients with aminoglycoside antibiotics induced HL (deafness, aminoglycoside-induced, OMIM: 561000.0001)6,7,8.
Currently, there are several hypotheses regarding the pathogenicity mechanism of the m.1555A > G variant of the MT-RNR1 gene. One of the hypotheses suggests that this variant can exhibit a pathogenic effect without modulating factors9,10,11. Since the adenine (A) to guanine (G) substitution in 1555 position of the MT-RNR1 gene leads to a change in the conservative A-site (aminoacyl-tRNA acceptor site) of 12S rRNA, this can lead to reading errors during the synthesis of oxidative phosphorylation proteins11. Another hypothesis is related to the modulating effect of aminoglycoside antibiotics. This assumption is based on the specific ability of the aminoglycosides to bind to the A-site of the 16S bacterial ribosome and thus selectively disrupt the synthesis of prokaryotic proteins without affecting eukaryotic ribosomes due to structural differences12,13. The A > G substitution at position 1555 of human 12S rRNA leads to a new C–G base pairing, which leads to similarity with the A-site of bacterial 16S rRNA, which is a target for aminoglycoside antibiotics14. Recently, using the methods of cryo-electron microscopy with chemical crosslinking/mass spectrometry, and in silico modeling, it was shown that the A > G substitution at position 1555 changes the secondary structure of human mitochondrial 12S rRNA, but does not affect folding, which indicates a greater role of the modulating factors in the pathogenicity of the m.1555A > G variant15,16.
Previously, to determine the most likely genetic forms of HL in the Republic of Buryatia, located in the Baikal Lake region of Russia (Eastern Siberia), a segregation analysis was carried out in 17 Buryat and 18 Russian families with hereditary history of HL17. This analysis suggested that the presumably hereditary cases of HL in Russian families (SF = 0.25 ± 0.07, at t = 0.64) have been segregating by the autosomal-recessive type of inheritance17. However, in Buryat families, the obtained segregation frequency of the HL (SF = 0.35 ± 0.05, at t = 0.38) was higher than theoretically expected for autosomal-recessive (SF0 = 0.25) and was lower than for autosomal-dominant type of inheritance (SF0 = 0.50). This result indicated the presence of other forms of HL in Buryat families that did not segregate with autosomal types of inheritance17. Subsequent molecular-genetic testing for the most common autosomal-recessive form of HL (DFNB1A, OMIM: 220290) confirmed that the contribution of causative variants of the GJB2 gene to the etiology of HL in Buryat patients was only 5.1% (one of the lowest rates in the world), while in Russian patients the contribution was 28.9%18, which was comparable with the results of segregation analysis17.
In this regard, the aim of this study is to analyze of the mitochondrial variant m.1555A > G in the MT-RNR1 gene in patients with HL in the Republic of Buryatia.
Results
Contribution of the m.1555A > G variant of the MT-RNR1 gene to the etiology of the HL in 165 patients in Republic of Buryatia
The m.1555A > G variant of the MT-RNR1 gene in the homoplasmic state was detected in 21 out of 165 studied patients with HL (Fig. 1). All 165 patients with HL were previously tested for the presence of pathogenic variants in the GJB2 gene associated with autosomal-recessive deafness, type 1A (DFNB1A, OMIM 220290)18. No causative variants in the GJB2 gene, including del(GJB6-D13S1830), del(GJB6-D13S1854) and del(GJB2-D13S175) were found in patients with the m.1555A > G variant in the MT-RNR1 gene. The average age of onset of HL in patients with the m.1555A > G variant of the MT-RNR1 gene was 2.7 years. In 85.8% of patients (n = 18) with this variant, bilateral profound sensorineural HL was confirmed. In the other 14.2% patients (n = 3), the severe degree of the HL was detected. In 23.8% of patients (n = 5) with the m.1555A > G variant we found a history of aminoglycoside use (Table S1). In this study, the total contribution of the m.1555A > G variant of the MT-RNR1 gene to the etiology of HL in the Republic of Buryatia was 12.7%. However, there were significant differences between two main ethnic groups of patients: a higher proportion of this pathogenic variant was found in Buryat patients (20.2%) than in Russian patients (1.3%) (Fig. 1).
Detection of the m.1555A > G variant of the MT-RNR1 gene and its contribution to the etiology of HL in the Republic of Buryatia. (A)—Detection of the m.1555A > G variant of the MT-RNR1 gene in 3% agarose gel by PCR–RFLP analysis with use of HaeIII: M—marker PUc19/MspI, lanes 1, 2, 4–6, 8—normal (wt), lanes 3 and 7—m.1555A > G (original electrophoregram presented in supplementary Fig. S1); (B)—Sanger sequencing of the MT-RNR1 gene fragment; (C)—The contribution of the m.1555A > G variant of the MT-RNR1 gene in patients with HL is calculated for all patients (21 out of 165 patients), the proportion of the m.1555A > G variant of the MT-RNR1 gene, depending on ethnicity is calculated for unrelated families.
Genetic-epidemiological analysis of the identified mitochondrial form of HL in the Republic of Buryatia
The prevalence of mitochondrial HL caused by the m.1555A > G variant of the MT-RNR1 gene in the Republic of Buryatia was 0.2 per 10,000 (Table 1). The highest prevalence was found in the southern regions with the maximum accumulation in the Dzhidinskii district, where its prevalence was 4.5 per 10,000. The lowest prevalence (from 0.02 to 0.75 per 10,000) of this form of deafness was registered in the city of Ulan-Ude and four northern districts of the Republic of Buryatia (Mukhorshibirsky, Kizhinginsky, Khorinsky and Kurumkansky districts) (Table 1).
Analysis of mtDNA haplogroups in patients with the m.1555A > G variant of the MT-RNR1 gene
Analysis of mitochondrial DNA haplogroups in 15 unrelated families with the m.1555A > G variant of the MT-RNR1 gene showed that A5b sub-haplogroup was present in 13 families (86.7%), the D5a2a1 sub-haplogroup in one family (6.7%), and sub-haplogroup F1a1d also in one family (6.7%) (Fig. 2). Interestingly, that among Buryat families with the m.1555A > G variant we found a whole cluster of the A5b sub-haplogroup lineages consisting of several subclades (A5b, A5b1 and A5b1b) with frequency of 92.9%, the minor lineage (D5a2a1) was detected with frequency 7.1%. In one Russian family with the m.1555A > G variant F1a1d sub-haplogroup was found (Fig. 2).
Topology of mtDNA haplogroups in 15 families with the m.1555A > G variant of the MT-RNR1 gene.
Discussion
In the present study, we carried out molecular-genetic screening for the m.1555A > G variant of the MT-RNR1 gene in mitochondrial DNA in 165 patients with HL from the Republic of Buryatia, located in the Baikal Lake region of Russia. The m.1555A > G variant of the MT-RNR1 gene contributed to the etiology of HL in 12.7% of the examined patients (21 out of 165). Notably, a high proportion of Buryat patients (20.2%) had the m.1555A > G variant compared to Russian patients (1.3%). It should be noted that this variant was not identified in the neighboring regions of South Siberia among Tuvinian (0/220) and Altaian (0/93) patients with HL19,20. However, the m.1555A > G variant has been identified in the northern parts of the Eastern Siberia, among Yakut (1/108) and Even (4/23) patients with HL21,22,23. This variant also has been found in Russian patients with HL from European part of Russia (4/102 and 1/122)21,24. In general, the prevalence of this variant in Russia is estimated at 1.18% (11/928) (Table S2)20,21,22,23,24.
In order to update the global prevalence of the m.1555A > G variant, we conducted a systematic review of the literature, encompassing a total of 47,328 HL patients (Fig. 3, Table S2). Our analysis indicates that the global prevalence of the m.1555A > G variant in HL patients stands at approximately 1.8% (863/47,328). Notably, the m.1555A > G variant exhibits higher prevalence in Asia at 2.48% (701/28,271). In contrast, the variant is observed at average frequencies in Africa (1.01%; 5/493) and the Middle East (1.43%; 10/698). The Europe, America, and Australia report relatively lower prevalence’s of 0.97% (90/9,237), 0.92% (50/5,409), and 0.22% (7/3,220), respectively (Fig. 3, Table S2).
The worldwide prevalence of the m.1555A > G variant of the MT-RNR1 gene among 47,328 patients with HL. Note: The full data is presented in the supplementary information (Table S2).
Some authors suggest that the relatively high prevalence of the m.1555A > G variant in Asia (2.48%) may be associated with a wider use of aminoglycoside antibiotics in countries of this region25,26,27,29. On the other hand, the relatively low prevalence of the m.1555A > G variant in Europe (0.97%) and America (0.92%) may be associated with underestimation of mitochondrial forms of HL (Table S2). As of now in the DNA-testing of the hereditary HL, including tests using NGS technologies, the pathogenic m.1555A > G variant of the MT-RNR1 gene is not included in all research protocols30. In general, despite the relatively low global prevalence of the m.1555A > G variant (from 0.22% in Australia to 2.48% in Asia), it is found across all continents (Fig. 3). The wide distribution of the m.1555A > G variant is probably due to its de novo emergence in different regions of the world, as there are known sporadic cases of the m.1555A > G variant31.
The first studies based on restriction fragment length polymorphism (RFLP) and D-loop sequencing of mitochondrial DNA among carriers of the m.1555A > G variant did not found common polymorphic patterns among patients of Caucasian, Asian and African descend32. Also, no common patterns were found among 10 families (out from 13) in Japan carrying the m.1555A > G variant, demonstrating the absence of a single origin of this pathogenic variant within one population29. Subsequent studies describing variability of mtDNA haplogroups in Chinese, Korean and Japanese pedigrees with the m.1555A > G variant, detected various haplogroups, predominantly of East-Eurasian origin (A, B, C, D, F, G, M, K, N, R and Y)28,29,33,34,35,36,37,38. In the United Kingdom, Spain and Cuba maternal lines of pedigrees carrying the m.1555A > G variant were affiliated with mtDNA haplogroups of West-Eurasian origin (H, I, J, K, T, U and V)9,39,40,41. In families from India both East- and West-Eurasian haplogroups (M5a’d, U2e1 and T2) were found42,43. In families of African descent with the m.1555A > G variant haplogroups L0 and L1 were identified32,33,44. These findings persuasively suggest that the m.1555A > G variant may occurred sporadically in situ and may have multiplied through the evolution of the mitochondrial DNA9,28,29,32,33,34,35,36,37,38,39,40,41,42,43,44. The phylogenetic trees of mtDNAs among the m.1555A > G variant carriers around the world are presented in the Supplementary information (Fig. S2).
Despite to the probability of the independent origin of the m.1555A > G variant in the different regions of the world, the extremely high prevalence of this variant has been identified in Spain (36.3%, 1200/3302) (Fig. 3, Table S2)45,46,47,48,49. Increased frequencies of the m.1555A > G variant only in this region of Europe suggest other factors contributing to spread of this pathogenic variant. However, the phylogenetic analysis of the complete mtDNA variation demonstrates that the MT-RNR1 gene is unlikely to be a hotspot region, because other known variants m.827A > G, m.961 T > C, and m.1005 T > C in this gene define sub-haplogroups, which are spread among Asians (B4b’d’e’j, A5b and F2) and Native Americans (B4b’d’e’j)33. In this case, the high proportion of the m.1555A > G variant in Spain, compared with other European countries, could possibly be related to exposure to exacerbating environmental factors and aminoglycoside treatment39. However, no significant differences in nutrition, living conditions and treatment methods were found between Spain and neighboring European countries39. Although different haplogroups have been identified among the m.1555A > G variant carriers in Spain, the majority of these carriers belonged to the haplogroup H (76%)39. The authors suggest that increased frequency of the m.1555A > G variant in patients with one haplogroup H (with three of the six studied haplotypes were specific for the m.1555A > G variant) in Spain may be due to a founder effect39. However, they emphasize, that haplogroup H is not specific to Spain, as this mitochondrial lineage is dominate in Europe, which does not exclude the possibility of an independent origin of the m.1555A > G variant on this major mitochondrial background39. Re-evaluation studies that further dissected mtDNA haplogroup H in Iberia confirmed that the previously reported overrepresentation of haplogroup H (38 from 50 individuals) among Spanish families affected by HL due to the m.1555A > G variant is primarily associated with sub-haplogroup H3 (15 from 38). This is believed to be the result of a significant, likely ancient, founder event associated with Franco-Cantabrian refuge area was the source of late-glacial expansions of hunter-gatherers that repopulated much of Central and Northern Europe approximately 15,000 years ago50.
The second region with high prevalence of the mitochondrial form of HL caused by the m.1555A > G variant of the MT-RNR1 gene, was found by us in the Baikal Lake region of Russia, where the proportion of the m.1555A > G variant among Buryat patients (20.2%) was comparable with Spanish patients (36.3%) (Fig. 3). We found local accumulation of the identified mitochondrial form of HL (4.5 per 10,000 peoples) in one district of the Republic of Buryatia (Table 1). We hypothesize that this uneven prevalence among the endogamous Siberian population could point to a founder effect, similar to Spanish carriers of the m.1555A > G variant in Iberia. To support this hypothesis, we conducted a complete mitochondrial genome analysis and identified the mtDNA haplogroups in 15 unrelated families carrying the m.1555A > G variant. Among these 15 pedigrees with the m.1555A > G variant, different sub-haplogroups were identified, all of which are belonged to East-Eurasians haplogroups: A, D, and F51,52,53,54,55,56,57,58,59,60,61. Specifically, we observed an overrepresentation of a single maternal lineage cluster (86.7%), affiliated with sub-haplogroup A5b (13 out of 14 Buryat patients). The remaining 13.4% individuals belonged to sub-haplogroup D5a2a1 (1 out 14 Buryat patients) and sub-haplogroup F1a1d (1 out of 1 Russian patient) (Fig. 2). Notably, all identified mitochondrial lineages were specific and had not been previously found among carriers of the m.1555A > G variant9,28,29,32,33,34,35,36,37,38,39,40,41,42,43,44. Although the phylogenetically close subclades (A5, F1 and D5) have been found in Japanese29,32,33, Chinese34,36 and Korean families with the m.1555A > G variant28 (Fig. S2).
Moreover, we noted with great interest, that maternal subclades (A5b, A5b1, A5b1b, D5a2a1 and F1a1d) detected in this study belong to clusters that are more prevalent in Eastern Asia57,58,61,62,63,64,65,66,67,68,69, than in regions of Northern Asia70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85. The clearest example is the mitochondrial lineage affiliated with sub-haplogroup A5b, which was detected among 92.9% of Buryat patients with m.1555A > G, and was previously unobserved either in general Buryat population83 or in other Mongolic-speaking peoples84. While the exact distribution range of the A5b lineage is still being defined, in continental Asia this sub-haplogroup has been found with minor rates among Turkic-speaking populations of Altaians, Kazakhs and Uighurs86,87, the phylogenetic analysis of haplogroup A5 indicates greater diversity of its different subclades in the Japanese archipelago56,61,68. In total, these findings suggest predominantly non-autochthonous East-Asian origin of the mitochondrial background among the m.1555A > G variant carriers in the Baikal Lake region, aligning with data of the multivariable ancestral components in the maternal genetic landscape of this Eastern Siberian region83,84.
In general, this study confirms that 92.9% of Buryat families affected by HL due to the m.1555A > G variant share a common cluster consisting of several subclades (A5b, A5b1, and A5b1b) of the mitochondrial lineage affiliated with sub-haplogroup A5b. This finding suggests a single origin of this pathogenic variant from a common ancestor in the majority of detected cases in the Baikal Lake region of Russia.
Methods
Brief information about studied region
The Republic of Buryatia includes 21 districts and two cities (Ulan-Ude and Severobaikalsk) (https://egov-buryatia.ru, accessed on 15 September 2022), with an area of 351.3 thousand km2. This region of the Russian Federation borders with Mongolia. The population of the Republic of Buryatia is 978,600 people, with an average density of 2.78 people/km2. The major ethnic groups are Buryats (30.1%) and Russians (59.4%) (https://burstat.gks.ru/vpn2020, accessed on 25 January 2023). The Buryats are a Mongolic-speaking people and one of the largest indigenous groups of Siberia. Buryats share many customs with Mongols, including nomadic herding and using portable dwellings—yurts. The majority of the Buryat population lives in the Republic of Buryatia, Irkutsk Oblast’ and Zabaykalsky Krai of Russia. Buryats also live in the northeastern part of Mongolia and China (Inner Mongolia).
Study sample
The DNA samples of 165 patients with HI from 160 unrelated families were collected in 2019. The majority of patients were of Buryat (47.8%; n = 79) and Russian ethnicity (46.1%; n = 76). Patients of other ethnicities accounted for 6.0% (n = 10). The males accounted for 41.2% (n = 68) and females—58.8% (n = 97). The average age was 50.7 ± 15.5 years.
Clinical and audiological analysis
For each patient, a medical history was collected, including the information on previous illnesses, allergological history, injuries and/or surgeries, the use of ototoxic drugs and the exposure to industrial noise. The hearing thresholds were determined by pure-tone audiometry, using a clinical tonal audiometer “AA222” (“Interacoustics”, Middelfart, Denmark), according to the current clinical standards. Air-conduction and bone conduction thresholds were obtained at 0.125, 0.25, 0.5, 1, 2, 4 and 8 kHz. Severity of hearing loss was defined by pure tone average (PTA0.5,1,2,4 kHz), as mild (25–40 dB), moderate (41–70 dB), severe (71–90 dB) or profound (above 90 dB).
Detection of the m.1555A > G variant in the MT-RNR1 gene
DNA was extracted using the phenol–chloroform method from the blood leukocytes. Detection of the m.1555A > G variant in the MT-RNR1 gene was performed by PCR–RFLP analysis using the previously described oligonucleotide primer, and restriction ferment HaeIII9. The presence of the m.1555A > G variant in the MT-RNR1 gene was verified by Sanger sequencing using the original sequence of oligonucleotide primers: F—AAACGCTTAGCCTAGCCACA, R—GCTACACTCTGGTTCGTCCA, selected using the Primer-BLAST program88.
Analysis of mtDNA haplogroups
Sequencing of the mitochondrial genome by next generation sequencing (NGS) was performed using Illumina NextSeq 500. Haplogroups were determined in accordance with PhyloTree.org mtDNA nomenclature—mtDNA tree Build 1789.
Ethics approval and consent to participate
All methods were performed in accordance with relevant guidelines and regulations. Written informed consent was obtained from all patients participating in the study. The study was conducted according to the guidelines of the Declaration of Helsinki and approved by the local Biomedical Ethics Committee at the Yakut Scientific Center of Complex Medical Problems, Yakutsk, Russia (Yakutsk, protocol No. 50 of 24 December 2019).
Conclusion
In this study we found the high prevalence of m.1555A > G variant of the MT-RNR1 gene among patients with HL residing in Baikal Lake region of Russia. This establishes Eastern Siberia as region with the second most extensive accumulation of mitochondrial form of HL in the world after South Europe. Analysis of the complete mitochondrial genome in 14 unrelated Buryat families carrying the m.1555A > G variant revealed common mitochondrial background affiliated with sub-haplogroup A5b (92.9%), which was not previously reported in the Eastern Siberia. Considering that over 90% of Buryat families affected by HL due to the m.1555A > G variant belong to one maternal lineage, we conclude that the high prevalence of this pathogenic variant in the Baikal Lake region is likely due to a founder effect. These findings expand our knowledge of the impact of the population bottleneck effects on the genetic epidemiology of the mitochondrial form of HL caused by the m.1555A > G variant of the MT-RNR1 gene.
Data availability
The raw datasets analyzed during the study are available from the corresponding author on reasonable request.
References
Morton, C. C. & Nance, W. Newborn hearing screening—A silent revolution. N. Engl. J. Med. 3, 54. https://doi.org/10.1056/NEJMra050700 (2006).
Del Castillo, F. J. & Del Castillo, I. DFNB1 non-syndromic hearing impairment: Diversity of mutations and associated phenotypes. Front. Mol. Neurosci. 10, 428. https://doi.org/10.3389/fnmol.2017.00428 (2017).
Del Castillo, I., Morín, M., Domínguez-Ruiz, M. & Moreno-Pelayo, M. A. Genetic etiology of non-syndromic hearing loss in Europe. Hum. Genet. 141, 683–696. https://doi.org/10.1007/s00439-021-02425-6 (2022).
Smith, R. J. H., Bale, J. F. & White, K. R. Sensorineural hearing loss in children. Lancet. 365, 879–890. https://doi.org/10.1016/S0140-6736(05)71047-3 (2005).
Lott, M. T. et al. MtDNA variation and analysis using mitomap and mitomaster. Curr. Protoc. Bioinf. 44, 1231–1326. https://doi.org/10.1002/0471250953.bi0123s44 (2013).
Prezant, T. R. et al. Mitochondrial ribosomal RNA mutation associated with both antibiotic-induced and non-syndromic deafness. Nat. Genet. 4, 289–294. https://doi.org/10.1038/ng0793-289 (1993).
Fischel-Ghodsian, N., Prezant, T. R., Bu, X. & Oztas, S. Mitochondrial ribosomal RNA gene mutation in a patient with sporadic aminoglycoside ototoxicity. Am. J. Otolaryngol. 14, 399–403. https://doi.org/10.1016/0196-0709(93)90113-l (1993).
Fischel-Ghodsian, N. et al. Mitochondrial gene mutation is a significant predisposing factor in aminoglycoside ototoxicity. Am. J. Otolaryngol. 18, 173–178. https://doi.org/10.1016/s0196-0709(97)90078-8 (1997).
Estivill, X. et al. Familial progressive sensorineural deafness is mainly due to the MtDNA A1555G mutation and is enhanced by treatment of aminoglycosides. Am. J. Hum. Genet. 62, 27–35. https://doi.org/10.1086/301676 (1998).
Matsunaga, T. et al. Deafness due to A1555G mitochondrial mutation without use of aminoglycoside. Laryngoscope. 114, 1085–1091. https://doi.org/10.1097/00005537-200406000-00024 (2004).
Hobbie, S. N. et al. Mitochondrial deafness alleles confer misreading of the genetic code. Proc. Natl. Acad. Sci. USA 105, 3244–3249. https://doi.org/10.1073/pnas.0707265105 (2008).
Hutchin, T. et al. Molecular basis for human hypersensitivity to aminoglycoside antibiotics. Nucleic Acids Res. 21, 4174–4179. https://doi.org/10.1093/nar/21.18.4174 (1993).
Guan, M. X., Fischel-Ghodsian, N. & Attardi, G. Biochemical evidence for nuclear gene involvement in phenotype of non-syndromic deafness associated with mitochondrial 12S RRNA mutation. Hum. Mol. Genet. 5, 963–971. https://doi.org/10.1093/hmg/5.7.963 (1996).
Hamasaki, K. & Rando, R. R. Specific binding of aminoglycosides to a human RRNA construct based on a DNA polymorphism which causes aminoglycoside-induced deafness. Biochemistry. 36, 12323–12328. https://doi.org/10.1021/bi970962r (1997).
Greber, B. J. et al. Ribosome. The complete structure of the 55s mammalian mitochondrial ribosome. Science. 348, 303–308. https://doi.org/10.1126/science.aaa3872 (2015).
Rovcanin, B. et al. In silico model of mtDNA mutations effect on secondary and 3D structure of mitochondrial rRNA and tRNA in Leber’s hereditary optic neuropathy. Exp Eye Res. 201, 108277. https://doi.org/10.1016/j.exer.2020.108277 (2020).
Pshennikova, V. G., Teryutin, F. M. & Barashkov, N. A. Clinical, audiological and genealogical analysis of hearing disorders in the Republic of Buryatia. Yakut Med. J. 72, 44–48. https://doi.org/10.25789/YMJ.2020.72.12 (2020).
Pshennikova, V. G. et al. The GJB2 (Cx26) gene variants in patients with hearing impairment in the Baikal Lake Region (Russia). Genes (Basel). 14, 1001. https://doi.org/10.3390/genes14051001 (2023).
Danilchenko, V. Y. et al. Different rates of the SLC26A4-related hearing loss in two indigenous peoples of Southern Siberia (Russia). Diagnostics 11, 2378. https://doi.org/10.3390/diagnostics11122378 (2021).
Danilchenko, V.Y. Analysis of genetic control of hereditary hearing loss in populations a number of regions of Si-beria [Russian: Danil'chenko V.Y. Analiz geneticheskogo kontrolya nasledstvennoy poteri slukha v pop-ulyatsiyakh ryada regionov Sibiri]. PhD thesis. Institute of Cytology and Genetics, Siberian Branch of Russian Academy of Sciences, Russian Federation, Novosibirsk. (2022)
Dzhemileva, L. U. et al. Analysis of mitochondrial 12S rRNA and tRNA(Ser(UCN)) genes in patients with nonsyndromic sensorineural hearing loss from various regions of Russia. Genetika. 45, 982–991 (2009).
Romanov, G. P., Barashkov, N. A. & Teryutin, F. M. Frequency of m.1555A>G mutation in MT-RNR1 gene of mitochondrial DNA among deaf individuals in Yakutia. Yakut Med. J. 59, 49–51 (2017).
Pshennikova, V. G., Teryutin, F. M., Romanov, G. P., Solovyov, A. V. & Barashkov, N. A. A local focus of accumulation of the mitochondrial form of hearing loss in Even-Bytantaysky district of Yakutia. Yakut Med. J. 80, 86–90. https://doi.org/10.25789/YMJ.2022.79.19 (2022).
Zhuravsky, S.G. Sensorineural hearing loss: molecular genetics, structural and therapeutic and preventive aspects (clinical and experimental study) [Russian: Zhuravskiy S.G. Sensonevral'naya tugoukhost': mole-kulyarno-geneticheskiye, strukturnyye i lechebno-profilakticheskiye aspekty (kliniko-eksperimental'noye issle-dovaniye]. Doctoral thesis. Pavlov First State Medical University of St. Petersburg, Russian Federation, St. Peters-burg. (2006)
Erdenechuluun, J. et al. Unique spectra of deafness-associated mutations in mongolians provide insights into the genetic relationships among Eurasian populations. PLoS One. 13, e0209797. https://doi.org/10.1371/journal.pone.0209797 (2018).
Guo, Y.-F. et al. Analysis of a large-scale screening of mitochondrial DNA m.1555A>G mutation in 2417 Deaf-Mute Students in Northwest of China. Genet. Test. Mol. Biomarkers. 14, 527–531. https://doi.org/10.1089/gtmb.2010.0020 (2010).
Usami, S. et al. Prevalence of mitochondrial gene mutations among hearing impaired patients. J. Med. Genet. 37, 38–40. https://doi.org/10.1136/jmg.37.1.38 (2000).
Bae, J. W. et al. Molecular and clinical characterization of the variable phenotype in Korean families with hearing loss associated with the mitochondrial A1555G mutation. PLoS One. 7, e42463. https://doi.org/10.1371/journal.pone.0042463 (2012).
Abe, S. et al. Phylogenetic analysis of mitochondrial DNA in Japanese pedigrees of sensorineural hearing loss associated with the A1555G mutation. Eur. J. Hum. Genet. 6, 563–569. https://doi.org/10.1038/sj.ejhg.5200239 (1998).
Elander, J. et al. Extended genetic diagnostics for children with profound sensorineural hearing loss by implementing massive parallel sequencing. Diagnostic outcome, family experience and clinical implementation. Int. J. Pediatr. Otorhinolaryngol. 159, 111218. https://doi.org/10.1016/j.ijporl.2022.111218 (2022).
Gu, P. et al. Clinical and molecular findings in a Chinese family with a de novo mitochondrial A1555G mutation. BMC Med Genomics. 15, 121. https://doi.org/10.1186/s12920-022-01276-y (2022).
Hutchin, T. P. & Cortopassi, G. A. Multiple origins of a mitochondrial mutation conferring deafness. Genetics. 145, 771–776 (1997).
Yao, Y. G., Salas, A., Bravi, C. M. & Bandelt, H. J. A reappraisal of complete mtDNA variation in East Asian families with hearing impairment. Hum. Genet. 119, 505–515. https://doi.org/10.1007/s00439-006-0154-9 (2006).
Tang, X. et al. Very low penetrance of hearing loss in seven Han Chinese pedigrees carrying the deafness-associated 12S rRNA A1555G mutation. Gene. 15, 11–19. https://doi.org/10.1016/j.gene.2007.01.001 (2007).
Wu, C. C., Chiu, Y. H., Chen, P. J. & Hsu, C. J. Prevalence and clinical features of the mitochondrial m.1555A>G mutation in Taiwanese patients with idiopathic sensorineural hearing loss and association of haplogroup F with low penetrance in three families. Ear Hear. 28, 332–342. https://doi.org/10.1097/AUD.0b013e318047941e (2007).
Lu, J. et al. Mitochondrial haplotypes may modulate the phenotypic manifestation of the deafness-associated 12S rRNA 1555A>G mutation. Mitochondrion. 10, 69–81. https://doi.org/10.1016/j.mito.2009.09.007 (2010).
Ding, Y. et al. Screening for deafness-associated mitochondrial 12S rRNA mutations by using a multiplex allele-specific PCR method. Biosci. Rep. 29, BSR20200778. https://doi.org/10.1042/BSR20200778 (2020).
Ding, Y., Teng, Y., Guo, Q. & Leng, J. Mitochondrial tRNAGln 4394C>T mutation may contribute to the clinical expression of 1555A>G-induced deafness. Genes. 13, 1794. https://doi.org/10.3390/genes13101794 (2022).
Torroni, A. et al. The A1555G mutation in the 12S rRNA gene of human mtDNA: Recurrent origins and founder events in families affected by sensorineural deafness. Am. J. Hum. Genet. 65, 1349–1358. https://doi.org/10.1086/302642 (1999).
del Castillo, F. J. et al. Heteroplasmy for the 1555A>G mutation in the mitochondrial 12S rRNA gene in six Spanish families with non-syndromic hearing loss. J. Med. Genet. 40, 632–636. https://doi.org/10.1136/jmg.40.8.632 (2003).
Elliott, H. R., Samuels, D. C., Eden, J. A., Relton, C. L. & Chinnery, P. F. Pathogenic mitochondrial DNA mutations are common in the general population. Am. J. Hum. Genet. 83, 254–260. https://doi.org/10.1016/j.ajhg.2008.07.004 (2008).
Khan, N. A., Govindaraj, P., Jyothi, V., Meena, A. K. & Thangaraj, K. Co-occurrence of m.1555A>G and m.11778G>A mitochondrial DNA mutations in two Indian families with strikingly different clinical penetrance of Leber hereditary optic neuropathy. Mol. Vis. 11, 1282–1289 (2013).
Subathra, M. et al. Complete mitochondrial genome analysis and clinical documentation of a five-generational Indian family with mitochondrial 1555A>G mutation and postlingual hearing loss. Ann. Hum. Genet. 78, 217–234. https://doi.org/10.1111/ahg.12061 (2014).
Human, H., Lombard, D., de Jong, G. & Bardien, S. A South African family with the mitochondrial A1555G mutation on haplogroup L0d. Biochem. Biophys. Res. Commun. 382, 390–394. https://doi.org/10.1016/j.bbrc.2009.03.032 (2009).
Bravo, O., Ballana, E. & Estivill, X. Cochlear alterations in deaf and unaffected subjects carrying the deaf-ness-associated A1555G mutation in the mitochondrial 12S rRNA gene. Biochem. Biophys. Res. Commun. 344, 511–516. https://doi.org/10.1016/j.bbrc.2006.03.143 (2006).
López-Bigas, N. et al. Mutations in the mitochondrial tRNA Ser(UCN) and in the GJB2 (Connexin 26) gene are not modifiers of the age at onset or severity of hearing loss in Spanish patients with the 12S RRNA A1555G mutation. Am. J. Hum. Genet. 66, 1465–1467. https://doi.org/10.1086/302870 (2000).
Gallo-Terán, J. et al. Prevalencia de la mutación a1555g en el adn mitocondrial en pacientes con patología auditiva o vestibular debida a la ototoxicidad de los aminoglucósidos. Acta Otorrinolaringol. Española. 55, 212–217. https://doi.org/10.1016/S0001-6519(04)78511-8 (2004).
Gallo-Terán, J. et al. Incidencias de Las Mutaciones A1555G en el ADN Mitocondrial y 35delG en el Gen GJB2 (Conexina 26) En Fa-milias Con Hipoacusia Neurosensorial Postlocutiva No Sindrómica En Cantabria. Acta Otorrinolaringol. Española. https://doi.org/10.1016/S0001-6519(02)78349-0 (2002).
Morales Angulo, C., Gallo-Terán, J., Señaris, B., Fontalva, A., González-Aguado, R., Fernández-Luna, J.L. Prevalencia de la mutación A1555G del gen MT-RNR1 en pacientes con hipoacusia postlocutiva sin antecedentes familiares de sordera. Acta Otorrinolaringol. Esp, 83–86. (2011)
Achilli, A. et al. The molecular dissection of mtDNA haplogroup H confirms that the Franco-Cantabrian glacial refuge was a major source for the European gene pool. Am. J. Hum. Genet. 75, 910–918. https://doi.org/10.1086/425590 (2004).
Cann, R. L., Stoneking, M. & Wilson, A. C. Mitochondrial DNA and human evolution. Nature. 325, 31–36 (1987).
Schurr, T. G. et al. Amerindian mitochondrial DNAs have rare Asian mutations at high frequencies, suggesting they derived from four primary maternal lineages. Am. J. Hum. Genet. 46, 613–623 (1990).
Torroni, A. et al. mtDNA variation of aboriginal Siberians reveals distinct genetic affinities with Native Americans. Am. J. Hum. Genet. 53, 591–608 (1993).
Cavalli-Sforza, L. L., Menozzi, P. & Piazza, A. The history and geography of human genes (Princeton University Press, 1994).
Maca-Meyer, N., González, A. M., Larruga, J. M., Flores, C. & Cabrera, V. M. Major genomic mitochondrial lineages delineate early human expansions. BMC Genet. 2, 13–20 (2001).
Kivisild, T. et al. The emerging limbs and twigs of the East Asian mtDNA tree. Mol. Biol. Evol. 19, 1737–1751. https://doi.org/10.1093/oxfordjournals.molbev.a003996 (2002).
Yao, Y. G. et al. Phylogeographic differentiation of mitochondrial DNA in Han Chinese. Am. J. Hum. Genet. 70, 635–651. https://doi.org/10.1086/338999 (2002).
Kong, Q.-P. et al. Mitochondrial DNA sequence polymorphisms of five ethnic populations from Northern China. Hum Genet. 113, 391–405. https://doi.org/10.1007/s00439-003-1004-7 (2003).
Richards, M., Macaulay, V., Torroni, A. & Bandelt, H. J. In search of geographical patterns in European mitochondrial DNA. Am. J. Hum. Genet. 71, 1168–1174. https://doi.org/10.1086/342930 (2002).
Palanichamy, M. G. et al. Phylogeny of mitochondrial DNA macrohaplogroup N in India, based on complete sequencing: im-plications for the peopling of South Asia. Am. J. Hum. Genet. 75, 966–978. https://doi.org/10.1086/425871 (2004).
Tanaka, M. et al. Mitochondrial genome variation in eastern Asia and the peopling of Japan. Genome Res. 14, 1832–1850. https://doi.org/10.1101/gr.2286304 (2004).
Zhang, X. et al. Analysis of mitochondrial genome diversity identifies new and ancient maternal lineages in Cambodian abo-rigines. Nat. Commun. 4, 2599. https://doi.org/10.1038/ncomms3599 (2013).
Kutanan, W. et al. Complete mitochondrial genomes of Thai and Lao populations indicate an ancient origin of Austroasiatic groups and demic diffusion in the spread of Tai-Kadai languages. Hum. Genet. 136, 85–98. https://doi.org/10.1007/s00439-016-1742-y (2017).
Park, S. et al. Entire mitochondrial DNA sequencing on massively parallel sequencing for the Korean population. J. Korean Med. Sci. 32, 587–592. https://doi.org/10.3346/jkms.2017.32.4.587 (2017).
Duong, N. T. et al. Complete human mtDNA genome sequences from Vietnam and the phylogeography of Mainland Southeast Asia. Sci. Rep. 8, 11651. https://doi.org/10.1038/s41598-018-29989-0 (2018).
Kim, J. et al. The origin and composition of Korean ethnicity analyzed by ancient and present-day genome sequences. Genome Biol. Evol. 12, 553–565. https://doi.org/10.1093/gbe/evaa062 (2020).
Yamamoto, K. et al. Genetic and phenotypic landscape of the mitochondrial genome in the Japanese population. Commun. Biol. 3, 104. https://doi.org/10.1038/s42003-020-0812-9 (2020).
Mizuno, F. et al. Population dynamics in the Japanese archipelago since the pleistocene revealed by the complete mitochondrial genome sequences. Sci. Rep. 11, 12018. https://doi.org/10.1038/s41598-021-91357-2 (2021).
Pham, V. H., Nguyen, V. L., Jung, H.-E., Cho, Y.-S. & Shin, J.-G. The frequency of the known mitochondrial variants associated with drug-induced toxicity in a Korean population. BMC Med. Genomics. 15, 3. https://doi.org/10.1186/s12920-021-01153-0 (2022).
Pakendorf, B. et al. Mitochondrial DNA evidence for admixed origins of central Siberian populations. Am. J. Phys. Anthropol. 120, 211–224. https://doi.org/10.1002/ajpa.10145 (2003).
Fedorova, S. A., Bermisheva, M. A., Villems, R., Maksimova, N. R. & Khusnutdinova, E. K. Analysis of mitochondrial DNA haplotypes in yakut population. Mol. Biol. (Mosk). 37, 643–653 (2003).
Zakharov, I. A. et al. Mitochondrial DNA variation in the aboriginal populations of the Altai-Baikal region: implications for the genetic history of North Asia and America. Ann. N. Y. Acad. Sci. 1011, 21–35. https://doi.org/10.1007/978-3-662-41088-2_3 (2004).
Starikovskaya, E. B. et al. Mitochondrial DNA diversity in indigenous populations of the Southern Extent of Siberia, and the origins of Native American haplogroups. Ann. Hum. Genet. 69, 67–89. https://doi.org/10.1046/j.1529-8817.2003.00127.x (2005).
Tarskaia, L. A. & Melton, P. Comparative analysis of mitochondrial DNA of Yakuts and other Asian populations. Genetika. 42, 1703–1711 (2006).
Derenko, M. et al. Phylogeographic analysis of mitochondrial DNA in Northern Asian populations. Am. J. Hum. Genet. 81, 1025–1041. https://doi.org/10.1086/522933 (2007).
Pakendorf, B., Novgorodov, I. N., Osakovskij, V. L. & Stoneking, M. Mating patterns amongst siberian reindeer herders: Inferences from mtDNA and Y-chromosomal analyses. Am. J. Phys. Anthropol. 133, 1013–1027. https://doi.org/10.1002/ajpa.20590 (2007).
Volodko, N. V. et al. Mitochondrial genome diversity in arctic siberians, with particular reference to the evolutionary history of beringia and pleistocenic peopling of the Americas. Am. J. Hum. Genet. 82, 1084–1100. https://doi.org/10.1016/j.ajhg.2008.03.019 (2008).
Crubézy, E. et al. Human evolution in Siberia: From frozen bodies to ancient DNA. BMC Evol. Biol. 10, 25. https://doi.org/10.1186/1471-2148-10-25 (2010).
Derenko, M. et al. Origin and post-glacial dispersal of mitochondrial DNA haplogroups C and D in Northern Asia. PLoS One. 5, e15214. https://doi.org/10.1371/journal.pone.0015214 (2010).
Derenko, M. et al. Complete mitochondrial DNA analysis of Eastern Eurasian haplogroups rarely found in populations of northern Asia and Eastern Europe. PLoS One. 7, e32179. https://doi.org/10.1371/journal.pone.0032179 (2012).
Fedorova, S. A. et al. Autosomal and uniparental portraits of the native populations of Sakha (Yakutia): Implications for the peopling of Northeast Eurasia. BMC Evol. Biol. 13, 127. https://doi.org/10.1186/1471-2148-13-127 (2013).
Dryomov, S. V. et al. Mitochondrial genome diversity at the bering strait area highlights prehistoric human migrations from Siberia to Northern North America. Eur. J. Hum. Genet. 23, 1399–1404. https://doi.org/10.1038/ejhg.2014.286 (2015).
Derenko, M., Denisova, G., Malyarchuk, B., Dambueva, I. & Bazarov, B. Mitogenomic diversity and differentiation of the Buryats. J. Hum. Genetics. 63, 71–81. https://doi.org/10.1038/s10038-017-0370-2 (2018).
Derenko, M., Denisova, G., Dambueva, I., Malyarchuck, B. & Bazarov, B. Mitogenomics of modern Mongol-ic-speaking populations. Mol. Genet. Genomics. 297, 47–62. https://doi.org/10.1007/s00438-021-01830-w (2022).
Derenko, M., Denisova, G., Litvinov, A., Dambueva, I. & Malyarchuk, B. Mitogenomics of the Koryaks and Evens of the Northern Coast of the Sea of Okhotsk. J. Hum. Genet. 68(10), 705–712. https://doi.org/10.1038/s10038-023-01173-x (2023).
Zheng, H. X. et al. MtDNA genomes reveal a relaxation of selective constraints in low-BMI individuals in a Uyghur population. Hum. Genet. 136, 1353–1362 (2017).
Askapuli, A. et al. Kazak mitochondrial genomes provide insights into the human population history of Central Eurasia. PLoS One 2917(11), e0277771. https://doi.org/10.1371/journal.pone.0277771 (2022).
Ye, J. et al. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinf. 13, 134. https://doi.org/10.1186/1471-2105-13-134 (2012).
van Oven, M. & Kayser, M. Updated comprehensive phylogenetic tree of global human mitochondrial DNA variation. Hum. Mutat. 30, 0386–0394. https://doi.org/10.1002/humu.20921 (2009).
Acknowledgements
This study was supported by the Ministry of Science and Higher Education of the Russian Federation (FSRG-2023-0003) (T.V.B., A.M.C., A.V.S., G.P.R. and S.A.F.) and YSC CMP project “Study of the genetic structure and burden of hereditary pathology of the populations of the Republic of Sakha (Yakutia)” (to V.G.P., F.M.T. and N.A.B.).
Author information
Authors and Affiliations
Contributions
Conceptualization, T.V.B., and N.A.B.; validation and formal analysis, A.M.C., F.M.T., G.P.R. and A.V.S.; investigation, A.A.B., I.V.M. O.A.B. and M.R.K.; resources, F.M.T. and V.G.P.; data curation, F.M.T. and V.G.P.; writing—original draft preparation, T.V.B., and N.A.B.; writing—review and editing, S.A.F. and N.A.B.; supervision, N.A.B.; project administration, N.A.B. and S.A.F.; funding acquisition, N.A.B. and S.A.F.
Corresponding author
Ethics declarations
Competing interests
The authors declare no competing interests.
Additional information
Publisher's note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Borisova, T.V., Cherdonova, A.M., Pshennikova, V.G. et al. High prevalence of m.1555A > G in patients with hearing loss in the Baikal Lake region of Russia as a result of founder effect. Sci Rep 14, 15342 (2024). https://doi.org/10.1038/s41598-024-66254-z
Received:
Accepted:
Published:
DOI: https://doi.org/10.1038/s41598-024-66254-z
Keywords
Comments
By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.
