Abstract
Cartilage-hair hypoplasia syndrome (CHH) is an autosomal recessive disorder frequently linked to n.72A>G (previously known as n.70A>G and n.71A>G), the most common RMRP variant worldwide. More than 130 pathogenic variants in this gene have already been described associated with CHH, and founder alterations were reported in the Finnish and Japanese populations. Our previous study in Brazilian CHH patients showed a high prevalence of n.197C>T variant (former n.195C>T and n.196C>T) when compared to other populations. The aim of this study was to investigate a possible founder effect of the n.197C>T variant in the RMRP gene in a series of CHH Brazilian patients. We have selected four TAG SNPs within chromosome 9 and genotyped the probands and their parents (23 patients previously described and nine novel). A common haplotype to the n.197C>T variant carriers was identified. Patients were also characterized for 46 autosomal Ancestry Informative Markers (AIMs). European ancestry was the most prevalent (58%), followed by African (24%) and Native American (18%). Our results strengthen the hypothesis of a founder effect for the n.197C>T variant in Brazil and indicate that this variant in the RMRP gene originated from a single event on chromosome 9 with a possible European origin.
Similar content being viewed by others
Introduction
Cartilage Hair Hypoplasia syndrome (CHH) is an autosomal recessive disease initially described by McKusick et al., 1965 in the Amish community1. Clinical signs include disproportionate short stature, hypotrichosis, anemia, impaired spermatogenesis, and Hirschsprung disease2,3,4,5. Patients often present immunological deficiencies with recurrent infections, higher incidence of autoimmunity diseases, and predisposition to cancer, in special lymphomas, reducing life expectancy6,7,8. Radiologically, it is observed short, splayed, and irregular metaphysis, especially at the knee regions. Although metaphyseal changes are the most expressive radiological feature, other radiological findings include short and thick tubular bones, short metacarpals and phalanges with cone-shaped epiphysis, curved femora, lumbar lordosis, and scoliosis9. Variations in the clinical phenotype inter-patients and even intra-families can be remarkable10. Also, CHH is one of thirty-six genetic diseases more prevalent in Finland (https://findis.org/)11 with an incidence estimated in 1/23,000 births in this population12. Prevalence for other geographical locations is not available.
CHH is characterized by biallelic pathogenic variants in the RMRP (mitochondrial RNA-processing endoribonuclease) gene located on chromosome 9p1313. This gene encodes a long non-coding RNA which is the core of RNAse MRP endoribonuclease14 responsible for many functions, such as rRNA processing, mitochondrial DNA replication and cell cycle progression15,16,17,18. Alterations can occur in the regulatory and transcribed regions13. Although CHH has been described more than 60 years ago, the genotype–phenotype correlation is still not well understood7. Currently, it is estimated that there are over 133 causative pathogenic variants in the RMRP gene19. Founder variants have already been described, such as n.72A>G variant, reported in the Finnish and Amish patients with CHH. This substitution accounts for 92% of the Finnish patients and it is present in 48% of non-Finnish Europeans patients either in homozygous or in compound heterozygous state10. Two other variants were associated with the Japanese population, n.220A>G and 17-bp dup at + 520. In a previous report of our group21, we described a cohort of 23 Brazilian patients with CHH and several pathogenic variants. Furthermore, we observed an unexpectedly high prevalence of the n.197C>T variant, unlike that observed in patients of other nationalities10,22,23,24, suggesting a possible founder effect (FE) in this population. This work aimed to investigate the hypothesis of a common ancestral origin of the n.197C>T variant in Brazil.
Results
Detection of RMRP variants
The current cohort is composed of 32 Brazilian patients with CHH, from different regions of Brazil (Northeast, Southeast, South and Federal District); being 23 patients previously evaluated21 and nine novel patients recruited in the present study. All genotypes are described in Table S1 (supplementary material online). It is noteworthy that 70% of the cohort (21/30), considering only one propositus in familial cases, present the n.197C>T variant in compound heterozygosity. On the other hand, only one patient presented the n.72A>G variant associated with a duplication in the regulatory portion of the RMRP gene (previously described by Ridanpää et al.10). Furthermore, no patient with homozygous genotype was observed.
Genetic ancestry of the cohort and Haplotype analysis
The average genomic contribution of each parental population (African, European and Native American) in the cohort was 24%, 58%, and 18%, respectively (Table 1, Supplementary Table S2 online). As the presence of n.197C>T variant was recurrent in patients from different regions of Brazil and rare in other countries, the hypothesis was raised that this alteration would have a single ancestral origin.
Allelic and haplotypic frequencies of the TAG SNPs based on 1000 Genomes data suggested the existence of 10 different haplotypes in Africans and Europeans (Table 2). This analysis also revealed that the region delimited by TAG SNPs was discriminatory between ancestral populations. The major haplotype in Europe (C/C/G/C) was less frequent in Africa (0.356 X 0.075, respectively). Conversely, the major haplotype in Africa (C/C/A/C) was less frequent in Europe (0.393 X 0.005, respectively).
Haplotype analysis was performed on samples from 27 unrelated patients from different regions of Brazil (Fig. 1), 18 being carriers of the n.197C>T variant (Table 2, supplementary Table S3 online). Siblings from the same family were expected to have the same haplotype; and, therefore, they were counted only once. Also, three patients carrying n.197C>T in compound heterozygosity were excluded due to insufficient material for haplotype analysis (patients 12, 13 and 28). The sequencing data of selected markers indicated a total of 7 distinct haplotypes in the Brazilian families. Of the 10 haplotypes inferred by Haploview, three were not found: T/G/G/A (frequency of 0.02% only in Europeans), C/G/G/C (frequency of 0.1% only in Africans), and T/C/A/C (frequency of 0.2% Europeans and 0.1% Africans).
Geographic Distribution of Haplotypes in Brazil. This figure illustrates the frequency of observed haplotypes across different states in Brazil. Individual haplotypes of the patients were determined through Sanger sequencing of selected TAG SNPs. Following haplotype counting, they were categorized based on their geographical location within the country. The size of the pie charts is proportional to the quantity of haplotypes observed in each region.
Seventeen out of eighteen chromosomes with the n.197C>T variant presented the T/C/G/A haplotype (94.4%) in comparison to 13 of the 36 chromosomes carrying the remaining variants analyzed (36.1%).
Also, all chromosomes carrying the n.97_98dup2(TG) and n.-25_-4dup22(TACTACTCTGTGAAGCTGAGAA) segregated within T/C/G/A (n = 4) and T/G/G/C (n = 6) haplotypes, respectively. Interestingly, the only chromosome carrying n.72A>g variant in our cohort (patient 10) presented the C/C/A/G haplotype, the most frequent in individuals from Europe (Table 2).
The haplotype diversity of all analyzed chromosomes was 0.64 (Table 3). On the other hand, when specifically observing the group of chromosomes that contained the n.197C>T variant, this value was considerably lower (0.11), especially when compared to the group of haplotypes that did not harbor this variant (0.76). In addition, the diversity for parental populations for the constructed panel of markers (based on data from the 1000 Genomes database) was 0.72 in Europe and 0.70 in Africa (Table 3). The association of the T/C/G/A haplotype with the n.197C>T variant for the Brazilian population of patients with CHH was demonstrated by Fisher's exact test (p < 0.001).
Discussion
This work focused on the study of a possible founder effect from a single country cohort outside Europe of patients with CHH. Previously, our group reported the clinical and molecular profile of 23 Brazilian patients with CHH showing an unexpectedly high prevalence of n.197C>T variant in the RMRP gene suggesting a possible founder effect21. The inclusion of nine novel patients in the present cohort, in which all but one individual presented the n.197C>T variant in one allele, corroborates with our previous results. It is noteworthy that there was no homozygous genotype for the n.197C>T variant. Despite the genetic diversity of the Brazilian population, we observed a significant prevalence of this specific genetic alteration, n.197C>T, in 70% of the analyzed patients, recruited from research centers in different regions of Brazil from 2016 to 2023. Although not all regions of Brazil are represented, the significant prevalence of the n.197C>T alteration in a mixed-race patient population reinforces the occurrence of the founder effect.
The n.197C>T variant was first reported in 200222 and since then, other studies showed this variant in compound heterozygosity genotype for individuals of different nationalities, in a frequency that did not exceed 11.1%10,23,24. In gnomAD v4.1.0 database (https://gnomad.broadinstitute.org/)25, the frequency of n.197C>T is 0.00003464 (24/692,778 alleles), being twelve alleles from Latin Americans, two from African/African-Americans, nine from non-Finnish Europeans and one from another ethnic group, reinforcing the low occurrence of this variant outside Brazil. On the other hand, there are 68 registers of this variant in a total of 65,000 alleles (frequency = 0.001) in the database of Mendelics (a private Genomic Laboratory of molecular genetics diagnosis in Brazil). Despite being a database that contains a clinical and numerical bias, this information reinforces that the frequency of this variant is still higher than expected among Brazilians. In ABraOM (https://abraom.ib.usp.br/index.php), another Brazilian database, composed by elderly healthy population there is only one register among 2,342 alleles (frequency = 0.000427).
Herein, we sequenced a group of genetic markers flanking the RMRP gene to determine if the n.197C>T variant occurred on a shared haplotype among patients. Considering that such a set of markers were selected to be highly diversified, it was expected a similar variability between the population of this study and the ancestral populations (0.70 in Africans and 0.72 Europeans) for the delimited region for all chromosomes analyzed. However, a similar level of haplotypic diversity was observed only for chromosomes non harboring the n.197C>T (Hd = 0.76). Interestingly, those harboring the variant showed a dramatic reduction in haplotypic diversity (0.11), reinforcing the hypothesis of a common ancestry for n.197C>T.
Our findings reveal that the n.197C>T variant is present within two distinct haplotypes (T/C/G/A and C/C/G/C), separated by two mutational steps. These variations likely stem from the most prevalent haplotype, T/C/G/A. Notably, the emergence of the C/C/G/C haplotype appears to be a result of mutations originating from the dominant T/C/G/A haplotype. If this were not the case, we would anticipate encountering the n.197C>T variant associated with a broader array of haplotypes, suggesting independent mutational events. To further elucidate the evolutionary history of this variant, it would be insightful to analyze haplotypes from individuals outside of Brazil who carry the n.197C>T variant. Such analysis could help determine whether this variant arose from a single occurrence and subsequently spread globally. These assays could also help us to trace its origin and subsequent expansion in Brazil since this variant was identified in patients from all over the country without geographical constraints. However, conducting this type of study is time-consuming and involves significant challenges, including establishing international collaborations, navigating variable healthcare systems and genetic data availability, and managing differing regulations and ethical guidelines.
Clinical presentation of patients carrying the variant n.197C>T did not differ from patients with other combinations of genotypes in our cohort. Interestingly, no homozygotes carrying the variant n.197C>T were found; and, from a genetic counseling perspective an autosomal recessive inheritance risk of 25% of recurrence should always be considered. Clinical management for CHH syndrome patients carrying the n.197C>T variant should not differ from patients with other pathogenic RMRP genotypes; and should follow recommendations for surveillance of known complications, such as lymphomas; monitoring all children regardless of immune status during the first two years of life for recurrent infections, especially life-threatening varicella infection and for immune-deficiency risk factors26.
The n.197C>T alteration in the Brazilian patients probably occurs in an individual of European origin since T/C/G/A haplotype is the second most frequent in individuals from this continent (0.325 in European, Table 2). The Brazilian population has a genetic contribution of Africans, Amerindians, and Europeans and the means of genomic ancestry are 14.7%, 6.7%, and 78.5% respectively27. In accordance with the majority of studies in the Brazilian population, the inferences analysis showed that our patients present a predominantly European genetic contribution28,29. Nevertheless, the difference between European and Amerindian throughout the literature could be attributed to some bias in the panel of markers used30,31. Taken together, these data strongly suggest that n.197C>T variant probably derived from an isolated event and was transmitted from a common ancestor with a possible European origin.
Finally, other recurrent variants in our cohort also seem to be potential founder effects for the Brazilian population, such as the n.98_99dup2(TG) variant which segregates within the same haplotype (T/C/G/A) as the n.197C>T variant in all four patients who presented this duplication. Also, the n. -24_-3dup22(TACTACTCTGTGAAGCTGAGAA) is associated with the T/G/G/C haplotype (0.125 in Europeans and 0.350 in Africans). In both cases, the sample size was relatively small, which could lead to a selection bias. Therefore, more investigations with a larger number of individuals carrying these variants need to be conducted.
In conclusion, a total of 54 haplotypes were analyzed and the results revealed a major haplotype associated with n.197C>T variant related to CHH in Brazil. This strongly suggests the occurrence of a founder effect of this variant in the Brazilian population, which may even help the implementation of public health policies.
Methods
Ethics approval
This study was performed in line with the principles of the Declaration of Helsinki. Approval was approved by the Ethics Committee of Instituto Nacional de Saúde da Mulher, da Criança e do Adolescente Fernandes Figueira—IFF/Fiocruz (https://www.iff.fiocruz.br/index.php/atuacao/pesquisa?view=article&layout=edit&id=5), Hospital de Clínicas de Porto Alegre (https://www.hcpa.edu.br/pesquisa/comite-de-etica-em-pesquisa-cep) and Universidade Estadual de Campinas (https://www.fcm.unicamp.br/fcm/pesquisa/comite-de-etica-em-pesquisa/fale-conosco), under the number 1.557.698.
Subjects and samples
Patients and their families were referred by their physicians from three Brazilian Medical Centers (Instituto Nacional de Saúde da Mulher, da Criança e do Adolescente Fernandes Figueira -IFF/Fiocruz; Grupo de Displasias Esquel��ticas, FCM -UNICAMP and Hospital de Clínicas de Porto Alegre—HCPA).
Patients’ recruitment started in June 2016. A total of 32 patients and their family members were enrolled in this study. Twenty-three patients from our previous study21 and nine novel patients with positive results for CHH were included.
This is a retrospective and prospective study that was approved by the IFF/Fiocruz Ethical Committee Board under the number 1.557.698. The written informed consent for clinical and molecular analyses was obtained from all subjects.
Peripheral blood samples were collected from patients and their parents, when available. Genomic DNA was extracted by the salting-out protocol32.
Admixture analysis
To infer the genomic ancestry of CHH Brazilian population we performed an individual admixture analysis using the AIMs (ancestry informative markers) panel. The inference of individual genomic percentages of African, European and Native American of 21 patients was performed by genotyping the 46-AIM-Indels multiplex according to the protocol described by Pereira et al.30. Fragments were detected using the ABI3500® sequencer (Applied Biosystems), and the generated products were analyzed using the GeneMapper ID v4.1 software. The individual ancestry estimates were calculated by STRUCTURE v2.3.4113 software, using HGDP-CEPH diversity panel as reference samples for ancestral populations31.
Selection of TAG SNP markers
To determine whether all studied chromosomes carrying n.197C>T variant (rs948931144) shared the same haplotype, we analyzed a panel of markers distributed around the RMRP gene. For these, the SNPs present in the region spanning 7000 bp upstream and downstream of the RMRP gene were extracted from the 1000 Genomes database33. Their allelic frequencies in parental populations were calculated using PLINK software. Genomic annotation was performed by the ANNOVAR database. The SNPs were filtered based on the following criteria: frequency above 0.1 in Africans (Esan in Nigeria [ESN], Gambian in Western Division—Mandinka [GWD], Luhya in Webuye, Kenya [LWK], Mende in Sierra Leone [MSL], Yoruba in Ibadan, Nigeria [YRI] and Europeans (CEPH/Utah Collection [CEU], Finnish in Finland [FIN], British From England and Scotland [GBR], Iberian Populations in Spain [IBS], Toscani in Italia [TSI]); only SNPs located in the intergenic region, upstream, intronic or downstream region of the gene. The TAG-SNPs and the haplotype frequencies in these populations were identified by HAPLOVIEW (rs10972552, rs7021463, rs1339374 and rs1361338).
Genotyping of TAG SNPs and data analysis
The region containing the TAG SNPs were PCR-amplified using patients and parental samples (PCR conditions available upon request) through Veriti 96-well thermal cycler (Thermo Fisher Scientific) and purified by High Pure PCR Product Purification Kit (Roche), according to the manufacturers’ instructions. Amplicons were sequenced by Sanger method on an automated DNA sequencer ABI 3730 (Applied Biosystems, Foster City, CA, USA) using BigDye v3.1 Sequencing Buffer (Applied Biosystems) as described by Otto et al., 200834. Sequence data were analyzed using BioEdit Software version 7.2 (Ibis Biosciences, Carlsbad, CA, USA). For haplotype assembly, the gametic phase of each TAG SNP was inferred using sequence data from family pedigree. When parental samples were not available, allelic discrimination was determined in patients´ samples by cloning the entire region containing the selected markers into a pGEM-T Cloning Vector (Promega) before sequencing. Allele frequencies were calculated by direct counting and haplotype diversity was calculated (h = 1 − ∑p2), as proposed by Nei35. Fisher's exact test was used to compare the frequencies between haplotypes carrying or not the n.197C>T variant.
Data availability
The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.
References
McKusick, V. A., Eldrige, R., Hostetler, J. A., Ruangwit, U. & Egeland, J. A. Dwarfism in the Amish. II. Cartilage-hair hypoplasia. Bull. Johns Hopkins Hosp. 116, 285–326 (1965).
Mäkitie, O., Tapanainen, P. J., Dunkel, L. & Siimes, M. A. Impaired spermatogenesis: An unrecognized feature of cartilage-hair hypoplasia. Ann. Med. 33(3), 201–205 (2001).
Williams, M. S. et al. The natural history of severe anemia in cartilage-hair hypoplasia. Am. J. Med. Genet. A 138(1), 35–40 (2005).
Kavadas, F. D. et al. Variability of clinical and laboratory features among patients with ribonuclease mitochondrial RNA processing endoribonuclease gene mutations. J. Allergy Clin. Immunol. 122(6), 1178–1184 (2008).
Ip, W. et al. Variable phenotype of severe immunodeficiencies associated with RMRP gene mutations. J. Clin. Immunol. 35(2), 147–157 (2015).
Vakkilainen, S. et al. A wide spectrum of autoimmune manifestations and other symptoms suggesting immune dysregulation in patients with cartilage-hair hypoplasia. Front. Immunol. 9, 2468 (2018).
Vakkilainen, S., Taskinen, M. & Mäkitie, O. Immunodeficiency in cartilage-hair hypoplasia: Pathogenesis, clinical course and management. Scand. J. Immunol. 92(4), e12913 (2020).
Kukkola, H. L. et al. Lymphomas in cartilage-hair hypoplasia: A case series of 16 patients reveals advanced stage DLBCL as the most common form. Front. Immunol. 13, 1004694 (2022).
Faitelson, Y. & Manson, D. Cartilage–hair hypoplasia: A spectrum of clinical and radiological findings. LymphoSign J. 2(3), 157–164 (2015).
Ridanpää, M. et al. Worldwide mutation spectrum in cartilage-hair hypoplasia: Ancient founder origin of the major70A–>G mutation of the untranslated RMRP. Eur. J. Hum. Genet. 10(7), 439–447 (2002).
Polvi, A. et al. The Finnish disease heritage database (FinDis) update-a database for the genes mutated in the Finnish disease heritage brought to the next-generation sequencing era. Hum. Mutat. 34(11), 1458–1466 (2013).
Mäkitie, O. Cartilage-hair hypoplasia in Finland: Epidemiological and genetic aspects of 107 patients. J. Med. Genet. 29(9), 652–655 (1992).
Ridanpää, M. et al. Mutations in the RNA component of RNase MRP cause a pleiotropic human disease, cartilage-hair hypoplasia. Cell 104(2), 195–203 (2001).
López, M. D., Rosenblad, M. A. & Samuelsson, T. Conserved and variable domains of RNase MRP RNA. RNA Biol. 6(3), 208–220 (2009).
Chang, D. D. & Clayton, D. A. Mouse RNAase MRP RNA is encoded by a nuclear gene and contains a decamer sequence complementary to a conserved region of mitochondrial RNA substrate. Cell 56(1), 131–139 (1989).
Schmitt, M. E. & Clayton, D. A. Nuclear RNase MRP is required for correct processing of pre-5.8S rRNA in Saccharomyces cerevisiae. Mol. Cell Biol. 13(12), 7935–41 (1993).
Cai, T. C., Aulds, J., Gill, T., Cerio, M. & Schmitt, M. E. The Saccharomyces cerevisiae RNase mitochondrial RNA processing is critical for cell cycle progression at the end of mitosis. Genetics 161(3), 1029–1042 (2002).
Vakkilainen, S. et al. The human long non-coding RNA gene RMRP has pleiotropic effects and regulates cell-cycle progression at G2. Sci. Rep. 9(1), 13758 (2019).
Sun, X. et al. Rmrp mutation disrupts chondrogenesis and bone ossification in zebrafish model of cartilage-hair hypoplasia via enhanced Wnt/β-catenin signaling. J. Bone Miner. Res. 34(11), 2101–2116 (2019).
Hirose, Y. et al. Identification of novel RMRP mutations and specific founder haplotypes in Japanese patients with cartilage-hair hypoplasia. J. Hum. Genet. 51(8), 706–710 (2006).
Gomes, M. E. et al. Identification of novel and recurrent RMRP variants in a series of Brazilian patients with cartilage-hair hypoplasia: McKusick syndrome. Mol. Syndromol. 10(5), 255–263 (2019).
Bonafé, L., Schmitt, K., Eich, G., Giedion, A. & Superti-Furga, A. RMRP gene sequence analysis confirms a cartilage-hair hypoplasia variant with only skeletal manifestations and reveals a high density of single-nucleotide polymorphisms. Clin. Genet. 61(2), 146–151 (2002).
Bonafé, L. et al. Evolutionary comparison provides evidence for pathogenicity of RMRP mutations. PLoS Genet. 1(4), e47 (2005).
Hermanns, P. et al. RMRP mutations in cartilage-hair hypoplasia. Am. J. Med. Genet. A 140(19), 2121–2130 (2006).
Karczewski, K. J. et al. The mutational constraint spectrum quantified from variation in 141,456 humans. Nature 581(7809), 434–443 (2020).
Mäkitie, O. & Vakkilainen, S. Cartilage-hair hypoplasia: Anauxetic dysplasia spectrum disorders. In GeneReviews® (eds Adam, M. P., Feldman, J., Mirzaa, G. M. et al.) (University of Washington, 2012).
Kehdy, F. S. et al. Origin and dynamics of admixture in Brazilians and its effect on the pattern of deleterious mutations. Proc. Natl. Acad. Sci. USA 112(28), 8696–701 (2015).
Godinho, N. M. O. et al. Regional patterns of genetic admixture in South America. Forensic Sci. Int. 1, 329–330 (2008).
Lins, T. C., Vieira, R. G., Abreu, B. S., Grattapaglia, D. & Pereira, R. W. Genetic composition of Brazilian population samples based on a set of twenty-eight ancestry informative SNPs. Am. J. Hum. Biol. 22(2), 187–192 (2010).
Pereira, R. et al. Straightforward inference of ancestry and admixture proportions through ancestry-informative insertion deletion multiplexing. PLoS ONE 7(1), e29684 (2012).
Manta, F. S. et al. Analysis of genetic ancestry in the admixed Brazilian population from Rio de Janeiro using 46 autosomal ancestry-informative indel markers. Ann. Hum. Biol. 40(1), 94–98 (2013).
Miller, S. A., Dykes, D. D. & Polesky, H. F. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. 16(3), 1215 (1988).
Abecasis, G. R. et al. An integrated map of genetic variation from 1,092 human genomes. Nature 491(7422), 56–65 (2012).
Otto, E. A. et al. Mutation analysis in nephronophthisis using a combined approach of homozygosity mapping, CEL I endonuclease cleavage, and direct sequencing. Hum. Mutat. 29(3), 418–426 (2008).
Nei, M. Molecular Evolutionary Genetics (Columbia University Press, 1987).
Acknowledgements
The authors wish to thank the patients and members of their families who participated in this study. Furthermore, the authors are grateful to the Plataforma Genômica—Sequenciamento de DNA—RPT01A (Rede de Plataformas Tecnológicas Fundação Oswaldo Cruz—FIOCRUZ) that performed all Sanger sequencing and Mendelics Laboratory for sharing their anonymous database.
Funding
This study was partially supported by funds from Conselho Nacional de Desenvolvimento Científico e Tecnológico—CNPq—INAGEMP (465549/2014-4), Coordenação de Aperfeiçoamento de Pessoal de N��vel Superior- CAPES—INAGEMP (88887.136366/2017–00) and Fundação de Amparo à Pesquisa do Estado do Rio Grande do Sul—FAPERGS—INAGEMP (17/2551-0000521-0). MEG was supported by fellowship from Coordenação de Aperfeiçoamento de Pessoal de Nível Superior—Brasil (CAPES)—Finance Code 001 and Fundação para o Desenvolvimento Científico e Tecnológico em Saúde—FIOTEC (VPPCB-002-FIO-22). The funders had no role in study design, data collection, and analysis, decision to publish, or preparation of the manuscript.
Author information
Authors and Affiliations
Contributions
MEG: conceptualization, patient genotyping, data curation, and manuscript writing. FK: construction of the panel of TAG SNPs, data curation and manuscript writing. FSNM: admixture experiments and manuscript review. DDGH: provision of patient samples and data and manuscript review. MTS: provision of patient samples and data. GLF: provision of patient samples and data. TMF: provision of patient samples and data. DPC: conceptualization, provision of patient samples and data and manuscript review. JCLJr: conceptualization, provision of patient samples and data, manuscript writing. SG: conceptualization, data curation, project administration and manuscript writing.
Corresponding author
Ethics declarations
Competing interests
The authors declare no competing interests.
Additional information
Publisher's note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary Information
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Gomes, M.E., Kehdy, F., de Neves-Manta, F.S. et al. Identification of a founder effect involving n.197C>T variant in RMRP gene associated to cartilage-hair hypoplasia syndrome in Brazilian patients. Sci Rep 14, 13436 (2024). https://doi.org/10.1038/s41598-024-64407-8
Received:
Accepted:
Published:
DOI: https://doi.org/10.1038/s41598-024-64407-8
Comments
By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.
